Bioinformin.net




This is a personal web, my notes on bioinformatics. The public part contains intro to flow cytometry, principle of protein array platform and tips on how to start with R programming language.

















The very old and ancient blog posts ...

The new ones are here.




git repo stats

23.07.2014

Bitbucket does not have any repository related statistics.
The way around it is gitstats.

In Ubuntu install with:
sudo apt-get install gitstats.

And run as:
gitstats /home/bioinformin/exomeMPS/ /home/bioinformin/exomeMPS_stats
firefox /home/bioinformin/exomeMPS_stats/index.html



sigAnnotateBoxplots

03.07.2014

I made R packege to annotate ggplot2 boxplots with significance clips and text. It lives at sigAnnotateBoxplots Bitbucket repository.

plot of chunk sigAnnotateBoxplots



shell history

09.06.2014

history … history of shell commands
<Ctrl+R> –> search_term –> <Enter> … search history and execute
<Ctrl+R> –> search_term –> <Right Arrow> … search history and edit command



vim survival commands

05.06.2014


<ESC> … get to COMMAND mode
i … get to INSERT mode (for editing)


:w … write (=save) (in COMMAND mode)
:x … save and exit (in COMMAND mode)
:q … quit (it won't let you if changes not saved) (in COMMAND mode)
:q! … quit discarding changes (you will not be prompted if changes not saved) (in COMMAND mode)



shell tips

03.01.2014

I have updated linux tips with these:

find . -name "._*" -type f -delete … find and delete files starting “._” recursively in a current folder
find . ! -name "*.txt" -type f … inverse find (all files not ending “.txt”)
ls -laFR … list files recursively (with folders contents)



Generate random FASTQ file

10.10.2013

For ASCII printable characters look at e.g. Wikipedia entry

# generate random 'DNA sequence':
set.seed(1234)
dna_seq <- paste(replicate(20, sample(c("A", "T", "G", "C"), 1)), sep = "", 
    collapse = "")

# generate random Phred quality scores:
set.seed(1234)
dna_qual_num <- replicate(20, sample(5:45, 1))  # numeric values
dna_qual_chr <- rawToChar(as.raw(dna_qual_num + 64))  # ad 64 for Phred+64 flavor


# print FASTQ:
cat("@SEQ_ID\n", dna_seq, "\n+\n", dna_qual_chr, sep = "")

## @SEQ_ID
## AGGGCGAAGGGGTCTCTTAA
## +
## I^]^h_EN`Za[PjPgPOLN

It takes more space to write numbers for quality values compared to ASCII characters: 

cat(paste(dna_qual_num, sep = "", collapse = ","), "\n", dna_qual_chr, sep = "")

## 9,30,29,30,40,31,5,14,32,26,33,27,16,42,16,39,16,15,12,14
## I^]^h_EN`Za[PjPgPOLN




Markdown to produce HTML guts to be inserted on the web

26.09.2013

I wanted a way to generate bits of a html without writing html tags. Some sort of markdown would serve this well. It should work as mini redaction system. This is how I have done that:

  • I used Rstudio to make R Markdown document. The markdown document gets knitted into html.
  • As part of the markdown document I have also a call to system command sed to extract the <body> part of the html and save it into plain text file. So when markdown is knitted the text file is also generated.
  • I uploaded the text file on the server. I added php include command to the web page which should include this html “chunk”.

That's it.

Step-by-step

  1. Create bloq_post.Rmd file in Rstudio
  2. In that file include this R code chunk (it gets executed when the bloq_post.Rmd is knitted):
    setwd("/path/to/your/blog_post") # set working directory system("sed -e '1,/<body>/d' -e'/^<\\/body>/,$d' bloq_post.html > bloq_post.txt") # extract body part of the html
  3. Knit the bloq_post.Rmd to get bloq_post.html and also bloq_post.txt
  4. Upload bloq_post.txt on your web server.
  5. In the web page to have the bloq_post.txt included (e.g. index.php) put something like:
    <?php $INC_DIR = $_SERVER["DOCUMENT_ROOT"]. "/www/"; include ($INC_DIR. "blog/bloq_post.txt"); ?>
  6. Done.

Notes

The <body> part of html extraction with sed was stolen from Jeromy Anglim (and adapted to exclude the <body> tag itself).

The markdown needs to be knitted twice (first round does not have the html with changes yet).

The bloq_post.txt can be also shared via Dropbox so no ftp is needed.